Changes in real-world dispensing of ADHD stimulants in youth from 2019 to 2021 in California.

Introduction: Attention-deficit/hyperactivity disorder (ADHD) is one of the most common pediatric neurobehavioral disorders in the U.S. Stimulants, classified as controlled substances, are commonly used for ADHD management. We conducted an analysis of real-world stimulants dispensing data to evaluate the pandemic's impact on young patients (≤ 26 years) in California. Methods: Annual prevalence of patients on stimulants per capita across various California counties from 2019 and 2021 were analyzed and further compared across different years, sexes, and age groups. New patients initiating simulants therapy were also examined. A case study was conducted to determine the impact of socioeconomic status on patient prevalence within different quintiles in Los Angeles County using patient zip codes. Logistic regression analysis using R Project was employed to determine demographic factors associated with concurrent use of stimulants with other controlled substances. Results: There was a notable reduction in prevalence of patients ≤26 years old on stimulants during and after the pandemic per 100,000 people (777 in 2019; 743 in 2020; 751 in 2021). These decreases were more evident among the elementary and adolescent age groups. The most prevalent age group on stimulants were adolescents (12-17 years) irrespective of the pandemic. A significant rise in the number of female patients using stimulants was observed, increasing from 107,957 (35.2%) in 2019 to 121,241 (41.1%) in 2021. New patients initiating stimulants rose from 102,754 in 2020 to 106,660 in 2021, with 33.2% being young adults. In Los Angeles County, there was an increasing trend in patient prevalence from Q1 to Q5 income quintiles among patients ≥6 years. Consistently each year, the highest average income quintile exhibited the highest per capita prevalence. Age was associated with higher risk of concurrent use of benzodiazepines (OR, 1.198 [95% CI, 1.195-1.201], p < 0.0001) and opioids (OR, 1.132 [95% CI, 1.130-1.134], p < 0.0001) with stimulants. Discussion: Our study provides real-world information on dispensing of ADHD stimulants in California youth from 2019 to 2021. The results underscore the importance of optimizing evidence-based ADHD management in pediatric patients and young adults to mitigate disparities in the use of stimulants.

High prevalence and diversity of Toxoplasma gondii DNA in feral cat feces from coastal California.

Toxoplasma gondii is a zoonotic parasite that can cause severe morbidity and mortality in warm-blooded animals, including marine mammals such as sea otters. Free-ranging cats can shed environmentally resistant T. gondii oocysts in their feces, which are transported through rain-driven runoff from land to sea. Despite their large population sizes and ability to contribute to environmental oocyst contamination, there are limited studies on T. gondii oocyst shedding by free-ranging cats. We aimed to determine the frequency and genotypes of T. gondii oocysts shed by free-ranging domestic cats in central coastal California and evaluate whether genotypes present in feces are similar to those identified in sea otters that died from fatal toxoplasmosis. We utilized a longitudinal field study of four free-ranging cat colonies to assess oocyst shedding prevalence using microscopy and molecular testing with polymerase chain reaction (PCR). T. gondii DNA was confirmed with primers targeting the ITS1 locus and positive samples were genotyped at the B1 locus. While oocysts were not visualized using microscopy (0/404), we detected T. gondii DNA in 25.9% (94/362) of fecal samples. We genotyped 27 samples at the B1 locus and characterized 13 of these samples at one to three additional loci using multi locus sequence typing (MLST). Parasite DNA detection was significantly higher during the wet season (16.3%, 59/362) compared to the dry season (9.7%; 35/362), suggesting seasonal variation in T. gondii DNA presence in feces. High diversity of T. gondii strains was characterized at the B1 locus, including non-archetypal strains previously associated with sea otter mortalities. Free-ranging cats may thus play an important role in the transmission of virulent T. gondii genotypes that cause morbidity and mortality in marine wildlife. Management of free-ranging cat colonies could reduce environmental contamination with oocysts and subsequent T. gondii infection in endangered marine mammals and people.

Sharing Patient Praises With Radiology Staff: Workflow Automation and Impact on Staff.

OBJECTIVE: This study aims to develop and evaluate a semi-automated workflow using natural language processing (NLP) for sharing positive patient feedback with radiology staff, assessing its efficiency and impact on radiology staff morale. METHODS: The HIPAA-compliant, institutional review board-waived implementation study was conducted from April 2022 to June 2023 and introduced a Patient Praises program to distribute positive patient feedback to radiology staff collected from patient surveys. The study transitioned from an initial manual workflow to a hybrid process using an NLP model trained on 1,034 annotated comments and validated on 260 holdout reports. The times to generate Patient Praises e-mails were compared between manual and hybrid workflows. Impact of Patient Praises on radiology staff was measured using a four-question Likert scale survey and an open text feedback box. Kruskal-Wallis test and post hoc Dunn's test were performed to evaluate differences in time for different workflows. RESULTS: From April 2022 to June 2023, the radiology department received 10,643 patient surveys. Of those surveys, 95.6% contained positive comments, with 9.6% (n = 978) shared as Patient Praises to staff. After implementation of the hybrid workflow in March 2023, 45.8% of Patient Praises were sent through the hybrid workflow and 54.2% were sent manually. Time efficiency analysis on 30-case subsets revealed that the hybrid workflow without edits was the most efficient, taking a median of 0.7 min per case. A high proportion of staff found the praises made them feel appreciated (94%) and valued (90%) responding with a 5/5 agreement on 5-point Likert scale responses. CONCLUSION: A hybrid workflow incorporating NLP significantly improves time efficiency for the Patient Praises program while increasing feelings of acknowledgment and value among staff.

Improving Pharmacist-Led Pediatric Patient Education on Oral Chemotherapy at Home.

Oral chemotherapy (OC) has been increasingly used in pediatric patients diagnosed with cancer, which is primarily managed in the outpatient setting. Different from adults, pediatric patients face unique challenges in administering these hazardous medications at home. Because of the complexity of pediatric pharmaceutical care and the hazardous nature of chemotherapy agents, comprehensive patient education is imperative to mitigate the potential safety risks associated with OC administration at home. Pharmacists play a vital role in patient education and medication consultations. However, the lack of practice guidelines and limited resources supporting OC counseling are noted. Additional barriers include insufficient knowledge and training on OC, which can be improved by continuing education. In a regional children's hospital, a comprehensive OC education checklist was developed for pediatric patients and their caregivers to standardize consultations led by pharmacists. An infographic OC handout was also formulated to improve patient knowledge and awareness. Moreover, innovative approaches such as using telepharmacy, smartphone applications, and artificial intelligence have been increasingly integrated into patient care, which can help optimize OC consultations for children and adolescents. Further studies are warranted to enhance oral chemotherapy education specifically tailored for pediatric patients in outpatient settings.

Sulfenylation links oxidative stress to protein disulfide isomerase oxidase activity and thrombus formation.

BACKGROUND: Oxidative stress contributes to thrombosis in atherosclerosis, inflammation, infection, aging, and malignancy. Oxidant-induced cysteine modifications, including sulfenylation, can act as a redox-sensitive switch that controls protein function. Protein disulfide isomerase (PDI) is a prothrombotic enzyme with exquisitely redox-sensitive active-site cysteines. OBJECTIVES: We hypothesized that PDI is sulfenylated during oxidative stress, contributing to the prothrombotic potential of PDI. METHODS: Biochemical and enzymatic assays using purified proteins, platelet and endothelial cell assays, and in vivo murine thrombosis studies were used to evaluate the role of oxidative stress in PDI sulfenylation and prothrombotic activity. RESULTS: PDI exposure to oxidants resulted in the loss of PDI reductase activity and simultaneously promoted sulfenylated PDI generation. Following exposure to oxidants, sulfenylated PDI spontaneously converted to disulfided PDI. PDI oxidized in this manner was able to transfer disulfides to protein substrates. Inhibition of sulfenylation impaired disulfide formation by oxidants, indicating that sulfenylation is an intermediate during PDI oxidation. Agonist-induced activation of platelets and endothelium resulted in the release of sulfenylated PDI. PDI was also sulfenylated by oxidized low-density lipoprotein (oxLDL). In an in vivo model of thrombus formation, oxLDL markedly promoted platelet accumulation following an arteriolar injury. PDI oxidoreductase inhibition blocked oxLDL-mediated augmentation of thrombosis. CONCLUSION: PDI sulfenylation is a critical posttranslational modification that is an intermediate during disulfide PDI formation in the setting of oxidative stress. Oxidants generated by vascular cells during activation promote PDI sulfenylation, and interference with PDI during oxidative stress impairs thrombus formation.

Engineered PROTAC-CID Systems for Mammalian Inducible Gene Regulation.

Gene regulation via chemically induced dimerization (CID) is useful for biomedical research. However, the number, type, versatility, and in vivo applications of CID tools remain limited. Here, we demonstrate the development of proteolysis-targeting chimera-based scalable CID (PROTAC-CID) platforms by systematically engineering the available PROTAC systems for inducible gene regulation and gene editing. Further, we show orthogonal PROTAC-CIDs that can fine-tune gene expression at gradient levels or multiplex biological signals with different logic gating operations. Coupling the PROTAC-CID platform with genetic circuits, we achieve digitally inducible expression of DNA recombinases, base- and prime-editors for transient genome manipulation. Finally, we package a compact PROTAC-CID system into adeno-associated viral vectors for inducible and reversible gene activation in vivo. This work provides a versatile molecular toolbox that expands the scope of chemically inducible gene regulation in human cells and mice.

Inhibition of interferon-gamma-stimulated melanoma progression by targeting neuronal nitric oxide synthase (nNOS).

Interferon-gamma (IFN-γ) is shown to stimulate melanoma development and progression. However, the underlying mechanism has not been completely defined. Our study aimed to determine the role of neuronal nitric oxide synthase (nNOS)-mediated signaling in IFN-γ-stimulated melanoma progression and the anti-melanoma effects of novel nNOS inhibitors. Our study shows that IFN-γ markedly induced the expression levels of nNOS in melanoma cells associated with increased intracellular nitric oxide (NO) levels. Co-treatment with novel nNOS inhibitors effectively alleviated IFN-γ-activated STAT1/3. Further, reverse phase protein array (RPPA) analysis demonstrated that IFN-γ induced the expression of HIF1α, c-Myc, and programmed death-ligand 1 (PD-L1), in contrast to IFN-α. Blocking the nNOS-mediated signaling pathway using nNOS-selective inhibitors was shown to effectively diminish IFN-γ-induced PD-L1 expression in melanoma cells. Using a human melanoma xenograft mouse model, the in vivo studies revealed that IFN-γ increased tumor growth compared to control, which was inhibited by the co-administration of nNOS inhibitor MAC-3-190. Another nNOS inhibitor, HH044, was shown to effectively inhibit in vivo tumor growth and was associated with reduced PD-L1 expression levels in melanoma xenografts. Our study demonstrates the important role of nNOS-mediated NO signaling in IFN-γ-stimulated melanoma progression. Targeting nNOS using highly selective small molecular inhibitors is a unique and effective strategy to improve melanoma treatment.

Changing trends in the microvascular reconstruction and oral rehabilitation following maxillary cancer.

PURPOSE: The maxillectomy defect is complex and the best means to achieve optimal reconstruction, and dental rehabilitation is a source of debate. The refinements in zygomatic implant techniques have altered the means and speed by which rehabilitation can be achieved and has also influenced the choice regarding ideal flap reconstruction. The aim of this study is to report on how the method of reconstruction and oral rehabilitation of the maxilla has changed since 1994 in our Institution, and to reflect on case mix and survival. METHODS: Consecutive head and neck oncology cases involving maxillary resections over a 27-year period between January 1994 and November 2020 were identified from hospital records and previous studies. Case note review focussed on clinical characteristics, reconstruction, prosthetic rehabilitation, and survival. RESULTS: There were 186 patients and the tumour sites were: alveolus for 56% (104), hard palate for 19% (35), maxillary sinus for 18% (34) and nasal for 7% (13). 52% (97) were Brown class 2 defects. Forty-five patients were managed by obturation and 78% (142/183) had free tissue transfer. The main flaps used were radial (52), anterolateral thigh (27), DCIA (22), scapula (13) and fibula (11). There were significant changes over time regarding reconstruction type, use of primary implants, type of dental restoration, and length of hospital stay. Overall survival after 24 months was 64% (SE 4%) and after 60 months was 42% (SE 4%). CONCLUSION: These data reflect a shift in the reconstruction of the maxillary defect afforded by the utilisation of zygomatic implants.

Autologous Fat Transfer Harvest-site Complications: Incidence, Risk Factors, and Management.

PURPOSE: Autologous fat transfer is an effective tool for volume restoration to the aging face. Although numerous reports exist regarding injection site complications, there is limited data on donor-site morbidity in the cosmetic surgery literature. METHODS: This study is a large-scale retrospective review to determine incidence of fat harvest-site complications, identify risk factors, and describe management strategies. Records of all patients who underwent autologous fat harvesting and facial grafting at a single oculofacial plastic surgery practice from 2010 to 2019 were reviewed. Patient demographics and clinical data were collected and assessed. A statistical analysis was performed using a two-tailed T-test with p values of <0.05 considered significant. RESULTS: Four-hundred sixteen patients were followed for an average of 6.2 months postoperatively. There was an overall 5.5% harvest-site complication rate. There was no correlation of harvest-site complications with gender (p = 0.249) or age (p = 0.881). Harvest location did not significantly correlate with complication rate. The most common complications were contour irregularities, prolonged induration, and prolonged erythema. Low body mass index was associated with higher complication rate (p = 0.003), even when excluding those patients with contour irregularities (p = 0.001). Various treatment modalities were used to manage donor-site morbidity with consistent improvement. CONCLUSIONS: Autologous fat transfer used for facial volume augmentation has low donor-site morbidity. Minor harvest-site complications occur more commonly in patients with low body mass index, irrespective of age, gender, or fat source.

The impact of blood pressure on the risk of major bleeding complication after renal transplant biopsy.

PURPOSE: To assess the impact of elevated blood pressure on the rate of major hemorrhagic complication after renal transplant biopsy. METHODS: Pre-procedural systolic (SBP), diastolic (SBP), and mean arterial (MAP) blood pressure for consecutive patients undergoing US-guided renal transplant biopsies from 08/01/2015 to 7/31/2017 were retrospectively recorded. Patients who had a major bleeding complication were identified. The risk of complication as a function of SBP, DBP, and MAP was statistically analyzed, with significance set at p < 0.05. RESULTS: Of 1689 biopsies, there were 10 bleeding complications (10/1689, 0.59%). There was no statistically significant difference between biopsies with complication compared to those without complication based on SBP (p = 0.351), DBP (p = 0.088), or MAP (p = 0.132). Using risk dichotomization criteria, the odds ratio for hemorrhagic complication when the patient had SBP ≥ 180 mmHg and DBP ≥ 95 mmHg was 75.63 (95% CI 6.87-516.8, p = 0.002). CONCLUSION: The rate of hemorrhagic complication from renal transplant biopsy is low, and there is no statistically significant threshold for increased biopsy risk based on SBP, DBP, or MAP alone. The risk of complication was significantly higher only when both the SBP is ≥ 180 mmHg and DBP is ≥ 95 mmHg.

The Flipped Ovary Sign in Ovarian Torsion.

The diagnosis of ovarian torsion is challenging and relies mostly on morphologic findings. Occasionally, women or children with acute pelvic pain who have undergone an initial ultrasound (US) evaluation with results interpreted as negative for ovarian torsion will return with recurrent or increasing pain, prompting an US reevaluation. The flipped ovary sign refers to a demonstrable change in the orientation of the ovary on follow-up US examinations, recognized by changing positions of ovarian landmarks established by follicles, cysts, or masses. This sign is valuable for identifying ovarian torsion in these patients, even in the absence of classic morphologic or Doppler features of ovarian torsion.

Detection of Bleeding Complications After Renal Transplant Biopsy.

OBJECTIVE. The purpose of this study was to analyze the timing of major bleeding complications after renal transplant biopsy in the context of a standardized 1-hour postprocedure observation protocol. MATERIALS AND METHODS. We retrospectively reviewed the electronic medical records for consecutive patients who underwent ultrasound-guided renal transplant biopsies between January 1, 2012, and December 31, 2017, and were observed according to a newly implemented 1-hour postprocedure observation protocol. The development of a major bleeding complication (Common Terminology Criteria for Adverse Events class 3 or higher) was recorded along with all available details regarding the time course of patient symptoms and presentation. Complications were grouped into one of four categories according to onset time after biopsy: 2 hours or less (timing category 1), more than 2 hours but 4 hours or less (timing category 2), more than 4 hours but 8 hours or less (timing category 3), and more than 8 hours (timing category 4). RESULTS. In 1824 patients (769 women, 1055 men) who underwent 4519 consecutive ultrasound-guided renal transplant biopsies during the study period, 11 class 3 complications were found (11/4519 [0.2%]). Four of the 11 patients (36.4%) had symptoms during the 1-hour observation period. Of these four patients, three (3/11 [27.3%]) had substantial symptoms related to major bleeding and were classified as timing category 1, and one (1/11 [9.1%]) had initially minor symptoms that increased in severity more than 2 hours but within 4 hours and was classified as timing category 2. Seven of the 11 patients (63.6%) did not have any symptoms at 1 hour of observation and were discharged; three (27.3%) were classified as timing category 3, and four (36.4%) were classified as category 4. CONCLUSION. Major bleeding complications following ultrasound-guided renal transplant biopsy are rare (0.2% of patients in this study). In our study, more than half were not clinically apparent within 4 hours of biopsy. A 1-hour postprocedure recovery period can be safely used after renal transplant biopsy.

Growth Rate of Ovarian Serous Cystadenomas and Cystadenofibromas.

OBJECTIVES: We analyzed growth rates of benign ovarian serous cystadenomas and cystadenofibromas to understand what percentage would show a volume doubling time (DT) of less than 3 years, between 3 and 5 years, or greater than 5 years. METHODS: We retrospectively reviewed pathology records (January 1, 2014, to June 30, 2019) to find all surgically excised ovarian serous cystadenomas and cystadenofibromas. Imaging records were then reviewed to identify those that had been confidently identified with ultrasound imaging, magnetic resonance imaging, or computed tomography at least twice before surgical removal, with at least a 60-day interval between studies. Three orthogonal measurements were recorded on the first and last imaging studies on which the mass was detected, with volume calculations by the prolate formula (product of 3 measurements multiplied by 0.52). The volume DT was calculated and grouped into 1 of 5 categories: (1) DT of less than 1 year; (2) DT of 1 to 3 years; (3) DT of 3 to 5 years; (4) DT of 5 to 10 years; and (5) no growth (any mass with a DT >10 years or showing a decrease in volume). RESULTS: A total of 102 of 536 cystadenomas and 44 of 227 cystadenofibromas met inclusion criteria. Of the 146 tumors, 40 (27.4%) had a DT of less than 1 year; 38 (26.0%) had a DT of 1 to 3 years; 22 (15.1%) had a DT of 3 to 5 years; 10 (6.8%) had a DT of 5 to 10 years; and 36 (24.7%) showed no growth. CONCLUSIONS: A total of 53.4% of ovarian serous cystadenomas/cystadenofibromas have a DT of less than 3 years; 15.1% have a DT between 3 and 5 years; and 31.5% have a DT of greater than 5 years or show no growth.

Radiologists Make More Errors Interpreting Off-Hours Body CT Studies during Overnight Assignments as Compared with Daytime Assignments.

Background There is increasing research attention on the impact of overnight work on radiologist performance. Prior studies on overnight imaging interpretive errors have focused on radiology residents, not on the relative performance of board-eligible or board-certified radiologists at night compared with during the day. Purpose To analyze the rate of clinically important interpretation errors on CT examinations of the abdomen, pelvis, or both ("body CT studies") committed by radiology fellows working off-hours based on day or night assignment. Materials and Methods Between July 2014 and June 2018, attending physicians at one tertiary care institution reviewed all body CT studies independently interpreted off-hours by radiologists in an academic fellowship within 10 hours of initial interpretation. Discrepancies affecting acute or follow-up clinical care were classified as errors. In this retrospective study, the error rate for studies interpreted during the day (between 7:00 am and 5:59 pm) was compared with that of studies interpreted at night (between 6:00 pm and 6:59 am). Error rate in the first half of day and night assignments was compared with error rate in the latter half. Statistical analyses used χ2 tests and general estimating equations; significance was defined as P < .05. Results There were 10 090 body CT studies interpreted by 32 radiologists. Forty-four of 2195 daytime studies (2.0%) had errors compared with 240 of 7895 nighttime studies (3.0%; P = .02). Twenty-two of 32 (69%) radiologists had higher error rates for night cases (P = .03). There were more errors in the last half of a night assignment (125 of 3358, 3.7%; P = .002) compared with the first half (115 of 4537, 2.5%). Conclusion On the basis of a subspecialty review, clinically important off-hours body CT interpretation errors occurred more frequently overnight and more frequently in the latter half of assignments, with more radiologists having worse error rates at night compared with the day. © RSNA, 2020 See also the editorial by Bruno in this issue.

Revealing the Unknown: Real-Time Recognition of Galápagos Snake Species Using Deep Learning.

Real-time identification of wildlife is an upcoming and promising tool for the preservation of wildlife. In this research project, we aimed to use object detection and image classification for the racer snakes of the Galápagos Islands, Ecuador. The final target of this project was to build an artificial intelligence (AI) platform, in terms of a web or mobile application, which would serve as a real-time decision making and supporting mechanism for the visitors and park rangers of the Galápagos Islands, to correctly identify a snake species from the user's uploaded image. Using the deep learning and machine learning algorithms and libraries, we modified and successfully implemented four region-based convolutional neural network (R-CNN) architectures (models for image classification): Inception V2, ResNet, MobileNet, and VGG16. Inception V2, ResNet and VGG16 reached an overall accuracy of 75%.

Comparison of Phasix, polypropylene, and primary closure of the abdominal donor site after bilateral free flap breast reconstruction: Long-term evaluation of abdominal hernia and bulge formation.

BACKGROUND: Abdominal free flap harvest for breast reconstruction may result in significant morbidity in terms of hernias and bulges. Reinforcement of the donor site with mesh has been recommended to minimize the risk of hernias and bulges, but no studies exist evaluating the optimal type of mesh. Polypropylene has traditionally been used but the development of Phasix restorable mesh may be a reasonable alternative. Here, we compared the use of Phasix to polypropylene and primary closure and hypothesize that the former has lower rates of abdominal morbidity in the long term. PATIENTS AND METHODS: A retrospective review of all patients undergoing bilateral free flap breast reconstruction from the abdomen was performed while patients with pedicle flaps or alternative donor sites were excluded. Patient demographics, medical/surgical history, cancer treatments, and flap type were analyzed. All patients were monitored for a minimum of 2 years for early donor site complications as well as hernia/bulges. RESULTS: Sixty-six consecutive patients were included (40 patients with Phasix, 20 patients with polypropylene, and 6 patients with primary closure). Use of Phasix mesh resulted in higher initial operative costs ($2,750 vs. $72 vs. $0). Two patients with polypropylene mesh and one patient undergoing primary closure developed an abdominal bulge in an average follow-up of 25.2 months (11.5% vs. 0%, p = .04). CONCLUSIONS: Mesh placement for abdominal wall reinforcement after bilateral free flap breast reconstruction minimizes the risk of hernias and bulges. Although Phasix results in increased initial costs, abdominal morbidity is significantly decreased after follow-up beyond 2 years.

The appropriateness of oral surgery referrals and treatment in contracted intermediate minor oral surgery practices in East Kent.

Objectives To assess the appropriateness of oral surgery referrals, after triage, to intermediate minor oral surgery (IMOS) practices in East Kent and whether or not referrals vary according to the referring general dental practitioner's (GDP's) place of qualification and experience.Design A retrospective study of the records of 441 triaged referrals sent to three IMOS practices in East Kent, over a ten-week period. An assessment tool was developed in line with local and national referral guidelines. Information on all referrals was obtained from the IMOS provider and referral records. Descriptive analysis of the data was performed.Results The most common reason for referral was for extraction of teeth requiring bone removal (n = 155; 35%). However, the majority of teeth removed were recorded as a non-surgical extraction (n = 363; 82%). Medical histories were included appropriately in the referral communications, with only 0.2% of all referrals being inappropriate. The proportion of appropriate and inappropriate referrals was very similar and it was found that referral rate was lower from dentists who had been qualified for more than ten years. GDPs working in the same location as the IMOS provider made a greater total number of referrals as well as more inappropriate referrals.Conclusions In the group of GDPs and IMOS providers studied, a wide variation was observed between the GDP's reason for referral and the treatment provided. It may be concluded that the vast majority of extractions were safely completed in an IMOS dental practice in a primary care setting.

Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.

Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

Methods to regulate gene expression programs in bacterial cells are limited by the absence of effective gene activators. To address this challenge, we have developed synthetic bacterial transcriptional activators in E. coli by linking activation domains to programmable CRISPR-Cas DNA binding domains. Effective gene activation requires target sites situated in a narrow region just upstream of the transcription start site, in sharp contrast to the relatively flexible target site requirements for gene activation in eukaryotic cells. Together with existing tools for CRISPRi gene repression, these bacterial activators enable programmable control over multiple genes with simultaneous activation and repression. Further, the entire gene expression program can be switched on by inducing expression of the CRISPR-Cas system. This work will provide a foundation for engineering synthetic bacterial cellular devices with applications including diagnostics, therapeutics, and industrial biosynthesis.